Review




Structured Review

Promega 5′ flanking t7 promoter
5′ Flanking T7 Promoter, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/5%E2%80%B2+flanking+t7+promoter/5++flanking+t7+promoter/pm39746937-430-24-29
Average 90 stars, based on 1 article reviews
5′ flanking t7 promoter - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

Synthesized:

Article Title: Reduced adult stem cell fate specification led to eye reduction in cave planarians.
Article Snippet: Double-stranded RNA (dsRNA) was synthesized as described before124: PCR-generated templates of sequences for the forward and reverse of target genes were prepared with a 5′ flanking T7 promoter (TAATACGACTCACTATAGGG) (Promega).

Article Title: Reduced adult stem cell fate specification led to eye reduction in cave planarians
Article Snippet: Double-stranded RNA (dsRNA) was synthesized as described before : PCR-generated templates of sequences for the forward and reverse of target genes were prepared with a 5′ flanking T7 promoter (TAATACGACTCACTATAGGG) (Promega).

Polymerase Chain Reaction:

Article Title: Reduced adult stem cell fate specification led to eye reduction in cave planarians.
Article Snippet: Double-stranded RNA (dsRNA) was synthesized as described before124: PCR-generated templates of sequences for the forward and reverse of target genes were prepared with a 5′ flanking T7 promoter (TAATACGACTCACTATAGGG) (Promega).

Article Title: Reduced adult stem cell fate specification led to eye reduction in cave planarians
Article Snippet: Double-stranded RNA (dsRNA) was synthesized as described before : PCR-generated templates of sequences for the forward and reverse of target genes were prepared with a 5′ flanking T7 promoter (TAATACGACTCACTATAGGG) (Promega).



Similar Products

90
Promega 5′ flanking t7 promoter
5′ Flanking T7 Promoter, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/5%E2%80%B2+flanking+t7+promoter/5++flanking+t7+promoter/pm39746937-430-24-29
Average 90 stars, based on 1 article reviews
5′ flanking t7 promoter - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results